70846
TriEx™UP Primer
Convenient sequencing and amplification of recombinant vectors
Para preguntas en general por favor contacte a nuestro Servicio de Atención al Cliente:
Merck KGaA
Frankfurter Str. 250
64293 Darmstadt
Germany
Teléfono: +49 6151 72-0
Fax: +49 6151 72 2000
14 febrero 2012
cargando
All TriEx™UP vector primers have been application-tested and are supplied ready to use at the working concentration (5 pmol/µl). Each vial contains a total of 500 pmol (100 µl) of oligonucleotide.
| Productos relacionados | |
|---|---|
| 70847 | TriEx™DOWN Primer |
| Productos relacionados para TriEx™UP Primer | |
| 70847 | TriEx™DOWN Primer |
| Información sobre producto | |||
|---|---|---|---|
| Oligo seqence | TriExUP Primer 5' - GGTTATTGTGCTGTCTCATCA - 3' | ||
| Almacenar y enviar información | |||
|---|---|---|---|
| Categoría de alamacenamiento | -20°C | ||
| Ship |
Shipped with Blue Ice or with Dry Ice
Standard Handling |
||
