70847
TriEx™DOWN Primer
Convenient sequencing and amplification of recombinant vectors
For general questions please contact our Customer Service:
Merck KGaA
Frankfurter Str. 250
64293 Darmstadt
Germany
Phone: +49 6151 72-0
Fax: +49 6151 72 2000
15 February 2012
loading
All TriEx™UP vector primers have been application-tested and are supplied ready to use at the working concentration (5 pmol/µl). Each vial contains a total of 500 pmol (100 µl) of oligonucleotide.
Mr: 6438
| Related products | |
|---|---|
| 70846 | TriEx™UP Primer |
| Related products for TriEx™DOWN Primer | |
| 70846 | TriEx™UP Primer |
| Product information | |||
|---|---|---|---|
| Oligo seqence | TriEx™DOWN Primer 5' - TCGATCTCAGTGGTATTTGTG - 3' | ||
| Store and ship information | |||
|---|---|---|---|
| Storage | -20°C | ||
| Ship |
Shipped with Blue Ice or with Dry Ice
Standard Handling |
||
