70847
TriEx™DOWN Primer
Convenient sequencing and amplification of recombinant vectors
Wenn Sie allgemeine Fragen haben, wenden Sie sich bitte an unseren Kundenservice:
Merck KGaA
Frankfurter Str. 250
64293 Darmstadt
Germany
Telefon: +49 6151 72-0
Fax: +49 6151 72 2000
14 Februar 2012
wird geladen
| Verwandte Produkte | |
|---|---|
| 70846 | TriEx™UP Primer |
| Verwandte Produkte für TriEx™DOWN Primer | |
| 70846 | TriEx™UP Primer |
| Produktinformationen | |||
|---|---|---|---|
| Oligo seqence | TriEx™DOWN Primer 5' - TCGATCTCAGTGGTATTTGTG - 3' | ||
| Lager- und Versandinformationen | |||
|---|---|---|---|
| Lagerkategorie | -20°C | ||
| Ship |
Shipped with Blue Ice or with Dry Ice
Standard Handling |
||





